- trash or not?
- Turn Table - Got Remix?!
- Serenity
- Hrm... >_>;
- New Spidah Man Sig
- BILLYtalent::
- en-TRA
- my sigges
- crysis WIP
- waterfalls
- One Life
- King Kong
- Ff9
- event. art.
- 2 New (cnc Plesae)
- Sexy
- Welcome to Aphex Tv
- moment of fear
- Every Day Life In Egypt
- Bad Boys ^^
- Drowning Pool ~
- 3 wallpapers
- assasin's
- my latest
- Amplify
- Collab with zLK
- New tag
- New Sig
- Lindsay Lohan Sig
- Omg I Had Sex With William Hung!
- My first in Photoshop
- B&W
- Naruto..
- My newest
- We have a CRYSIS on our hands
- first sprite tag:)
- soNaive
- only because its raining.
- Newest Sig
- grotto
- Daylight Come
- what a whore
- Trying new things
- Not sure on this one
- Destiny
- I can rob you with a banana...
- Kelly Clarkson
- absteerack
- New sig
- Spill Your Heart Out
- kronic
- Cold Fear
- lima
- What Television Kills
- Let It Begin
- Rebcca Romaijn
- B&W tag........my first........xD
- Blooming Of Chocolate (2)
- a few recent.
- Jade empire
- havent made 1 in a while
- Collateral
- first sig in a while
- I <3 Alba
- Eurynomos
- latest tag
- Jessica Alba :D
- dead.
- The Elebits
- Gift for Deri
- Omg A Zombie!
- My Best Sig Ever
- blast yo radiio
- blast yo radiio
- yb bhunb
- new.
- Lenny Kravitz
- Predator
- spidey
- Gift for scAr_cicone
- Nightcrawler Tag..
- is it semi pro?
- Neverwinter Nights
- function.1
- Summer
- 1st sig in ages
- Adrianna Lima
- 2006
- Tattoo
- xmen sprite
- Back
- Logo
- || Ayumi Hamasaki Vectors ||
- latest
- its been a while.
- halo2 oldskool
- It's a sig...you know the drill.
- china
- Vice
- inter?
- Mission Impossible 26
- [LP] Chaos of the Twenty First century
- When weed makes you think you did something good....
- semi?
- tagwall
- i tried to do a lp
- a WIP
- omfg halo 4?!
- Pro Attempt
- Fergie Tag
- Renegade
- quasi lp thing
- Sprite
- new new new. (cnc please)
- Jessica Biel
- good spidey vs evil spidey XD
- Kliff Undersn
- BaD DaY: new onee
- Sky high
- rihanna
- pizixel
- Mariah Carey
- spider man
- Hmm..pro yet?
- Gone Fishing.
- Lost Minds
- Hmmm Class this and advice plz
- Dream
- Gift for NyteShade
- can u class this sig and critic
- sigeys
- m o t i o n
- || Liz Hurley Tag, 2 versions ||
- Coolio
- same old abstract
- A few of mine
- sprite
- Girl
- Clarkson
- ttttttttaaaaaaaaaggggg
- Paris/class pls :P
- you decide...
- good, bad: Mischa Barton
- Street Fighter
- Disturbed
- Lineart FTW
- hysteria
- Take Me
- Illustrator Fun xD
- Atlantis - new large peice from the lovable fallacy
- newest
- Batman
- WIP Victoria Secret Model
- Should I reclass?
- belle
- 2 New Tags
- boa mmm k?
- Natalie Portman! =O
- Spirited away
- look here even if you don't want to
- Gungrave O:
- Self-Titled Piece
- Illy ftw (x2)
- Sig I Made For Wkkid
- Shme
- First Illustrator
- spiderman
- milo's logo
- Semi maybe? oO
- Technozzz
- inter? o.O
- more
- Daredevil
- halo manip
- here it is
- here they are
- Zegna
- Ghost Recon
- another sprite
- Biel
- Roni Size
- Spiderman
- I can kick your butt in any fighting game...
- Couple recent
- latest
- latest mates some comments
- 2 Recent
- nacho
- Predator Tag, needs C&C
- Katie Holmes
- sprite
- Soldier
- First sprite sig
- fable
- Ehh, Just Experimenting
- Bryan Fury
- new sprite
- Breakdance
- class teh siggah
- some of my work
- Don't Cry...
- Three.... Count em..... THREE Assassin's Creed sigs.
- New tag, how is it?
- Semi?
- log1c
- hmm my best style mayb
- semi like my current?
- scrolls
- antix and the crew
- this dude looks nutz.
- Jessica Alba
- Mariah Carey
- Oh God A Sig!
- Eva Longoria
- Bang Bang
- Spiderman
- assasins creed
- Sunset
- light
- Blurred. OMG PRO?
- Novice..but why?!
- Waiting ...
- [LP] Over the Horizon
- Strained
- Gift I Made For .Renegade
- two new, please comment
- AbyssMechania & Mysteriously Delicious
- charisma carpenter
- SPIDERMAN tag
- Assassins Creed
- Mother And Childs
- Ice Assault
- Arctic Monkeys
- SUITURES [Vector]
- t2t2t2t2t2t2t2
- Opensurgery + A Sign
- Subconscious Strange Sensation
- Broken!!!!!!
- Newest
- streamside submission
- Antix and Fusion collab
- I don't know what to think
- Need For Speed: Carbon
- Sensual\Adriana Lima ^^
- Splinter Cell
- Hitsu Taichou sig
- ( no, really, they are )
- Nature
- shining beauty
- 3t. very unhappy with this =/